CBSE Class 10CBSE Class 11CBSE Class 12CBSE CLASS 9

NEET 2023 Biology Question Paper with Solutions PDF

NEET 2023 Biology Question Paper with Solutions PDF

एनईईटी जीव विज्ञान क्वेश्चन पेपर पीडीएफ– NEET की परीक्षा में विज्ञान की तीनों शाखाओं से प्रश्न पूछे जाते हैं. जिसमें सबसे अहम विषय जीव विज्ञान है .क्योंकि नीट की परीक्षा जीव विज्ञान के प्रश्न काफी पूछे जाते हैं. तो जो विद्यार्थी NEET परीक्षा की तैयारी कर रहा है .उसके लिए इस पोस्ट में एनईईटी जीव विज्ञान प्रश्नोत्तरी जीव विज्ञान के महत्वपूर्ण प्रश्न उत्तर NEET 2023 Biology Question Paper दिए गए हैं जिससे कि वह अपनी तैयारी ज्यादा अच्छे से कर सके .जो भी विद्यार्थी एनईईटी की तैयारी कर रहे है. उसके लिए यह प्रश्न उत्तर बहुत फायदेमंद है उन्हें ध्यानपूर्वक पढ़ें .

My contact number

एक झिल्ली के आर-पार आयनों की सांद्रता प्रवणता के विरुद्ध उनकी गति और संचय को इसके द्वारा समझाया जा सकता है

(1) सुगम प्रसार
(2) निष्क्रिय परिवहन
(3) सक्रिय परिवहन
(4) परासरण
उत्तर. सक्रिय परिवहन

My contact number

‘द एविल क्वार्टेट’ में से किसको प्रजातियों के विलुप्त होने का सबसे महत्वपूर्ण कारण माना जाता है?

(1) आर्थिक लाभ के लिए अत्यधिक शोषण
(2) विदेशी प्रजातियों का आक्रमण
(3) सह-विलुप्त होना
(4) पर्यावास हानि और विखंडन
उत्तर. पर्यावास हानि और विखंडन

My contact number

निम्नलिखित में से हेटरोस्पोरस टेरिडोफाइट्स की जोड़ी की पहचान करें:

(1) सेलाजिनेला और साल्विनिया
(2) साइलोटम और साल्विनिया
(3) इक्विसेटम और साल्विनिया
(4) लाइकोपोडियम और सेलाजिनेला
उत्तर. सेलाजिनेला और साल्विनिया

My contact number

गुणसूत्र पर उनकी स्थिति को मैप करने के लिए जीनों के बीच की दूरी के माप के रूप में एक ही गुणसूत्र पर जीन जोड़े के बीच पुनर्संयोजन की आवृत्ति का उपयोग पहली बार किसके द्वारा किया गया था?

(1) सटन और बोवेरी
(2) अल्फ्रेड स्टुरटेवेंट
(3) हेनकिंग
(4) थॉमस हंट मॉर्गन
उत्तर. अल्फ्रेड स्टुरटेवेंट

मक्के के भुट्टे में लटकन का क्या कार्य है?

(1) परागकणों को फँसाने के लिए
(2) परागकणों को बिखेरने के लिए
(3) बीजों की रक्षा के लिए
(4) कीड़ों को आकर्षित करने के लिए
उत्तर. परागकणों को फँसाने के लिए

सही कथन पहचानें: A. डिट्रिवोर्स विखंडन करते हैं बी. खनिजीकरण के दौरान कुछ रोगाणुओं द्वारा ह्यूमस को और अधिक निम्नीकृत किया जाता है C. पानी में घुलनशील अकार्बनिक पोषक तत्व मिट्टी में चले जाते हैं और लीचिंग नामक प्रक्रिया द्वारा अवक्षेपित हो जाते हैं D. अपरद खाद्य श्रृंखला जीवित जीवों से शुरू होती है ई. केंचुए अपचय नामक प्रक्रिया द्वारा मलबे को छोटे कणों में तोड़ देते हैं नीचे दिए गए विकल्प में से सही उत्तर चुनें:

(1) केवल बी, सी, डी
(2) केवल सी, डी, ई
(3) केवल डी, ई, ए
(4) केवल ए, बी, सी
उत्तर. केवल ए, बी, सी

नीचे दो कथन दिए गए हैं: एक को अभिकथन A के रूप में लेबल किया गया है और दूसरे को कारण R के रूप में लेबल किया गया है: अभिकथन A: देर की लकड़ी में संकीर्ण वाहिकाओं के साथ कम जाइलरी तत्व होते हैं कारण R : कैम्बियम सर्दियों में कम सक्रिय होता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है

पुनर्संयोजन नोड्यूल्स की उपस्थिति की प्रक्रिया अर्धसूत्रीविभाजन में प्रोफ़ेज़ I के किस उप चरण में होती है?

(1) पचीटीन
(2) डिप्लोटीन
(3) डायकाइनेसिस
(4) जाइगोटीन
उत्तर. पचीटीन

अर्धसूत्रीविभाजन के निम्नलिखित में से किस चरण में सेंट्रोमियर का विभाजन शामिल है?

(1) मेटाफ़ेज़ II
(2) एनाफ़ेज़ II
(3) टेलोफ़ेज़
(4) मेटाफ़ेज़ I
उत्तर. एनाफ़ेज़ II

पुनः संयोजक डीएनए प्रौद्योगिकी के लिए शुद्धिकरण प्रक्रिया के दौरान, ठंडा इथेनॉल अवक्षेपित हो जाता है

(1) डीएनए
(2) हिस्टोन्स
(3) पॉलीसेकेराइड्स
(4) आरएनए
उत्तर. डीएनए

फैबेसी परिवार सोलानेसी और लिलियासी से भिन्न है पुंकेसर के संबंध में, परिवार के लिए विशिष्ट विशेषताओं को चुनें फैबेसी लेकिन सोलानेसी या लिलियासी में नहीं पाया जाता है

(1) पॉलीडेल्फस और एपिपिटलस पुंकेसर
(2) मोनोएडेल्फ़स और मोनोथेकस परागकोश
(3) एपिफ़िलस और डाइथेकस परागकोश
(4) डायडेल्फ़स और डाइथेकस परागकोष
उत्तर. डायडेल्फ़स और डाइथेकस परागकोष

बड़े, रंग-बिरंगे, रसयुक्त सुगंधित फूल इनमें देखे जाते हैं:

(1) पक्षी परागणित पौधे
(2) चमगादड़ परागित पौधे
(3) पवन परागणित पौधे
(4) कीट परागित पौधे
उत्तर. कीट परागित पौधे

किशोर कोनिफर्स पर निम्नलिखित में से किस फाइटोहोर्मोन का छिड़काव परिपक्वता अवधि को तेज करने में मदद करता है, जिससे बीज का उत्पादन जल्दी होता है?

(1) जिबरेलिक एसिड
(2) ज़ीटिन
(3) एब्सिसिक एसिड
(4) इंडोल-3-ब्यूटिरिक एसिड
उत्तर. जिबरेलिक एसिड

एक्साइल प्लेसेंटेशन देखा जाता है

(1) चाइना गुलाब, बीन्स और ल्यूपिन
(2) टमाटर, डायन्थस और मटर
(3) चाइना गुलाब, पेटुनिया और नींबू
(4) सरसों, खीरा और प्रिमरोज़
उत्तर. चाइना गुलाब, पेटुनिया और नींबू

यूकेरियोट्स में डीएनए की प्रतिकृति होती है –

(1) एस चरण
(2) जी1 चरण
(3) जी2 चरण
(4) एम चरण
उत्तर. एस चरण

केल्विन चक्र के दौरान ग्लूकोज के एक अणु के संश्लेषण के लिए कितने ATP और NADPH2 की आवश्यकता होती है?

(1) 18 एटीपी और 12 एनएडीपीएच
2 (2) 12 एटीपी और 16 एनएडीपीएच2
(3) 18 एटीपी और 16 एनएडीपीएच2
(4) 12 एटीपी और 12 एनएडीपीएच2
उत्तर. 18 एटीपी और 12 एनएडीपीएच

मेजबान कोशिकाओं में विदेशी डीएनए को पेश करने के लिए इस्तेमाल की जाने वाली जीन गन विधि में धातु के सूक्ष्म कणों का उपयोग किया जाता है

(1) जस्ता
(2) टंगस्टन या सोना
(3) चांदी
(4) तांबा
उत्तर. टंगस्टन या सोना

वायुमंडल में वायु के एक स्तंभ में ओजोन की मोटाई को निम्न के रूप में मापा जाता है:

(1) डेसीबल
(2) डेकामीटर
(3) किलोबेस
(4) डॉब्सन इकाई
उत्तर. डॉब्सन इकाई

डीएनए आनुवंशिक सामग्री है इसका स्पष्ट प्रमाण सबसे पहले किसके द्वारा प्रस्तावित किया गया था?

(1) अल्फ्रेड हर्षे और मार्था चेज़
(2) एवरी, मैकलॉइड और मैकार्थी
(3) विल्किंस और फ्रैंकलिन
(4) फ्रेडरिक ग्रिफ़िथ
उत्तर. अल्फ्रेड हर्षे और मार्था चेज़

समीकरण GPP – R = NPP में GPP सकल प्राथमिक उत्पादकता है NPP शुद्ध प्राथमिक उत्पादकता R है

(1) श्वसन भागफल
(2) श्वसन हानि
(3) प्रजनन आवंटन
(4) प्रकाश संश्लेषक रूप से सक्रिय विकिरण
उत्तर. श्वसन हानि

यूकेरियोट्स में प्रतिलेखन की प्रक्रिया में आरएनए पोलीमरेज़ III की क्या भूमिका है?

(1) टीआरएनए, 5 एसआरआरएनए और एसएनआरएनए का प्रतिलेखन
(2) एमआरएनए के अग्रदूत का प्रतिलेखन
(3) केवल एसएनआरएनए का प्रतिलेखन
(4) आरआरएनए का प्रतिलेखन (28एस, 18एस और 5.8एस)
उत्तर. टीआरएनए, 5 एसआरआरएनए और एसएनआरएनए का प्रतिलेखन

प्रकाश संश्लेषण के दौरान जल के अणु के विखंडन के लिए किस सूक्ष्म पोषक तत्व की आवश्यकता होती है?

(1) मोलिब्डेनम
(2) मैग्नीशियम
(3) तांबा
(4) मैंगनीज
उत्तर. मैंगनीज

एंजियोस्पर्म में, निषेचित भ्रूण थैली की अगुणित, द्विगुणित और त्रिगुणित संरचनाएँ क्रमिक रूप से होती हैं:

(1) एंटीपोडल्स, सिनर्जिड्स और प्राथमिक एंडोस्पर्म न्यूक्लियस
(2) सिनर्जिड्स, जाइगोट और प्राइमरी एंडोस्पर्म न्यूक्लियस
(3) सिनर्जिड्स, एंटीपोडल्स और पोलर न्यूक्लियस
(4) सिनर्जिड्स, प्राइमरी एंडोस्पर्म न्यूक्लियस और जाइगोट
उत्तर. सिनर्जिड्स, जाइगोट और प्राइमरी एंडोस्पर्म न्यूक्लियस

प्लियोट्रोपिज्म की घटना को संदर्भित करता है

(1) दो एलील्स की उपस्थिति, दोनों जीनों में से प्रत्येक एक एकल गुण को नियंत्रित करता है
(2) एक एकल जीन एकाधिक फेनोटाइपिक अभिव्यक्ति को प्रभावित करता है
(3) एक ही लक्षण को प्रभावित करने वाले दो से अधिक जीन
(4) एकल क्रॉसओवर को नियंत्रित करने वाले एकल जीन के कई एलील्स की उपस्थिति
उत्तर. एक एकल जीन एकाधिक फेनोटाइपिक अभिव्यक्ति को प्रभावित करता है

नीचे दो कथन दिए गए हैं: एक को अभिकथन A के रूप में लेबल किया गया है और दूसरे को कारण R के रूप में लेबल किया गया है: अभिकथन A: एटीपी का उपयोग ग्लाइकोलाइसिस में दो चरणों में किया जाता है कारण आर: पहले एटीपी का उपयोग ग्लूकोज को ग्लूकोज-6-फॉस्फेट में बदलने में किया जाता है और दूसरे एटीपी का उपयोग फ्रुक्टोज-6-फॉस्फेट को फ्रुक्टोज-1- 6-डिफॉस्फेट में बदलने में किया जाता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है

सेल्युलोज आयोडीन के साथ नीला रंग नहीं बनाता है, क्योंकि

(1) यह एक पेचदार अणु है
(2) इसमें जटिल हेलिकॉप्टर नहीं होते हैं और इसलिए यह आयोडीन अणुओं को धारण नहीं कर सकता है
(3) जब आयोडीन इसके साथ क्रिया करता है तो यह टूट जाता है
(4) यह एक डिसैकराइड है
उत्तर. इसमें जटिल हेलिकॉप्टर नहीं होते हैं और इसलिए यह आयोडीन अणुओं को धारण नहीं कर सकता है

कौन सा हार्मोन गहरे पानी वाले चावल में इंटर्नोड/पेटिओल बढ़ाव को बढ़ावा देता है?

(1) काइनेटिन
(2) एथिलीन
(3) 2, 4-डी
(4) जीए3
उत्तर. एथिलीन

व्यक्त अनुक्रम टैग (ईएसटी) को संदर्भित करता है

(1) सभी जीन जिन्हें प्रोटीन के रूप में व्यक्त किया जाता है
(2) सभी जीन चाहे व्यक्त हों या अव्यक्त
(3) कुछ महत्वपूर्ण व्यक्त जीन
(4) सभी जीन जिन्हें आरएनए के रूप में व्यक्त किया जाता है
उत्तर. सभी जीन जिन्हें आरएनए के रूप में व्यक्त किया जाता है

नीचे दो कथन दिए गए हैं: कथन I: वाष्पोत्सर्जन द्वारा उत्पन्न बल पानी के जाइलम आकार के स्तंभ को 130 मीटर से अधिक ऊंचाई तक उठा सकते हैं कथन II: वाष्पीकरणीय शीतलन द्वारा वाष्पोत्सर्जन पत्ती की सतहों को कभी-कभी 10 से 15 डिग्री तक ठंडा कर देता है उपरोक्त कथनों के आलोक में, नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सही है
(4) कथन I और कथन II दोनों सही हैं
उत्तर. कथन I और कथन II दोनों सही हैं

यूवी विकिरण के संपर्क में आने पर, एथिडियम ब्रोमाइड से सना हुआ डीएनए दिखाई देगा

(1) चमकीला नीला रंग
(2) चमकीला पीला रंग
(3) चमकीला नारंगी रंग
(4) चमकीला लाल रंग
उत्तर. चमकीला नारंगी रंग

जैविक विविधता पर ऐतिहासिक सम्मेलन, ‘द अर्थ समिट’ किस वर्ष रियो डी जनेरियो में आयोजित किया गया था:

(1) 1992
(2) 1986
(3) 2002
(4) 1985
उत्तर. 1992

पीएस II में प्रतिक्रिया केंद्र में अवशोषण मैक्सिमा है

(1) 700 एनएम
(2) 660 एनएम
(3) 780 एनएम
(4) 680 एनएम
उत्तर. 680 एनएम

नीचे दो कथन दिए गए हैं: एक को अभिकथन ए के रूप में लेबल किया गया है और दूसरे को कारण आर के रूप में लेबल किया गया है: अभिकथन ए: मॉस के जीवन चक्र में गैमेटोफाइट का पहला चरण प्रोटोनिमा चरण है कारण आर: प्रोटोनिमा सीधे कैप्सूल में उत्पादित बीजाणुओं से विकसित होता है उपरोक्त कथनों के आलोक में, नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) ए और आर दोनों सही हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सही है लेकिन आर सही नहीं है
(3) ए सही नहीं है लेकिन आर सही है
(4) ए और आर दोनों सही हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए और आर दोनों सही हैं और आर, ए का सही स्पष्टीकरण है

टिशू कल्चर प्रयोगों में, कैलस बनाने के लिए पत्ती मेसोफिल कोशिकाओं को कल्चर माध्यम में रखा जाता है इस घटना को इस प्रकार कहा जा सकता है:

(1) विभेदीकरण
(2) विकास
(3) बुढ़ापा
(4) विभेदीकरण
उत्तर. विभेदीकरण

नीचे दो कथन दिए गए हैं: कथन I: एंडार्च और एक्सार्च शब्द अक्सर पौधे के शरीर में द्वितीयक जाइलम की स्थिति का वर्णन करने के लिए उपयोग किए जाते हैं कथन II: एक्सार्च स्थिति जड़ प्रणाली की सबसे आम विशेषता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें;

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I गलत है लेकिन कथन II सत्य है

सही कथनों को पहचानें: A. लेंटिसल्स लेंस के आकार के खुले भाग हैं जो गैसों के आदान-प्रदान की अनुमति देते हैं B. मौसम की शुरुआत में बनने वाली छाल को कठोर छाल कहा जाता है सी. बार्क एक तकनीकी शब्द है जो संवहनी कैम्बियम के बाहरी सभी ऊतकों को संदर्भित करता है डी. छाल पेरिडर्म और सेकेंडरी फ्लोएम को संदर्भित करता है ई. फेलोजन मोटाई में एकल-परत है नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल ए और डी
(2) केवल ए, बी और डी
(3) केवल बी और सी
(4) केवल बी, सी और ई
उत्तर. केवल ए और डी

सूची I को सूची II से सुमेलित करें: सूची I सूची II A. सामंजस्य I. तरल चरण में अधिक आकर्षण B. आसंजन II पानी के अणुओं के बीच पारस्परिक आकर्षण C. सतह तनाव III. तरल चरण में पानी की कमी D. गुटेशन IV. ध्रुवीय सतहों के प्रति आकर्षण नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-IV, B-III, C-II, DI
(2) A-III, BI, C-IV, D-II
(3) A-II, BI, C-IV, D-III
(4) ) A-II, B-IV, CI, D-III
उत्तर. A-II, B-IV, CI, D-III

सूची I को सूची II से मिलाएँ: सूची I सूची II A. M चरण I. प्रोटीन संश्लेषित होते हैं B. G2 चरण II निष्क्रिय चरण सी. शांत चरण III. माइटोसिस और डीएनए प्रतिकृति की शुरुआत के बीच का अंतराल डी. जी1 चरण IV समीकरणीय विभाजन नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-IV, B-II, CI, D-III
(2) A-IV, BI, C-II, D-III
(3) A-II, B-IV, CI, D-III
(4) ) A-III, B-II, C-IV, DI
उत्तर. A-IV, BI, C-II, D-III

क्लाइनफेल्टर सिंड्रोम के बारे में निम्नलिखित में से कौन सा कथन सही है? A. इस विकार का वर्णन सबसे पहले लैंगडन डाउन (1866) ने किया था B. ऐसे व्यक्ति का संपूर्ण पौरुष विकास होता है हालाँकि, स्त्री विकास भी व्यक्त किया गया है C. प्रभावित व्यक्ति छोटे कद का होता है D. शारीरिक, मनोदैहिक और मानसिक विकास मंद हो जाता है ई. ऐसे व्यक्ति बाँझ होते हैं नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल सी और डी
(2) केवल बी और ई
(3) केवल ए और ई
(4) केवल ए और बी
उत्तर. केवल बी और ई

नीचे दो कथन दिए गए हैं: कथन I: गॉज़ के ‘प्रतिस्पर्धी बहिष्करण सिद्धांत’ में कहा गया है कि समान संसाधनों के लिए प्रतिस्पर्धा करने वाली दो निकट संबंधी प्रजातियां अनिश्चित काल तक सह-अस्तित्व में नहीं रह सकती हैं और प्रतिस्पर्धात्मक रूप से कमजोर एक को अंततः समाप्त कर दिया जाएगा कथन II: सामान्य तौर पर, शाकाहारी जानवरों की तुलना में मांसाहारी जानवरों पर प्रतिस्पर्धा का अधिक प्रतिकूल प्रभाव पड़ता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I सही है लेकिन कथन II गलत है

राइबोसोम कितने विभिन्न प्रोटीनों से मिलकर बना होता है?

(1) 60
(2) 40
(3) 20
(4) 80
उत्तर. 80

केमियोस्मोसिस के लिए निम्नलिखित में से कौन सा संयोजन आवश्यक है?

(1) झिल्ली, प्रोटॉन पंप, प्रोटॉन ग्रेडिएंट, एनएडीपी सिंथेज़
(2) प्रोटॉन पंप, इलेक्ट्रॉन ग्रेडिएंट, एटीपी सिंथेज़
(3) प्रोटॉन पंप, इलेक्ट्रॉन ग्रेडिएंट, एनएडीपी सिंथेज़
(4) झिल्ली, प्रोटॉन पंप, प्रोटॉन ग्रेडिएंट, एटीपी सिंथेज़
उत्तर. झिल्ली, प्रोटॉन पंप, प्रोटॉन ग्रेडिएंट, एटीपी सिंथेज़

निम्नलिखित में से कौन सा कथन सही नहीं है?

(1) पानी में कार्बनिक पदार्थों की अधिकता के कारण शैवाल के खिलने से पानी की गुणवत्ता में सुधार होता है और मत्स्य पालन को बढ़ावा मिलता है
(2) जलकुंभी यूट्रोफिक जल निकायों में प्रचुर मात्रा में बढ़ती है और जल निकाय के पारिस्थितिकी तंत्र की गतिशीलता में असंतुलन पैदा करती है
(3) क्रमिक पोषण स्तर पर जीवों में औद्योगिक अपशिष्ट जल के कुछ विषैले पदार्थों की मात्रा बढ़ जाती है
(4) सीवेज प्रदूषित जल निकाय में कार्बनिक पदार्थों के जैव निम्नीकरण में शामिल सूक्ष्म जीव बहुत अधिक ऑक्सीजन का उपभोग करते हैं जिससे जलीय जीवों की मृत्यु हो जाती है
उत्तर. पानी में कार्बनिक पदार्थों की अधिकता के कारण शैवाल के खिलने से पानी की गुणवत्ता में सुधार होता है और मत्स्य पालन को बढ़ावा मिलता है

सूची I को सूची II से सुमेलित करें: सूची I सूची II (इंटरैक्शन) (प्रजाति A और B) A. पारस्परिकता I. +(A), O(B) B. सहभोजिता II -(ए), ओ(बी) सी. एमेंसलिज़्म III +(ए), -(बी) डी. परजीविता IV. +(ए), +(बी) नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-IV, B-I, C-II, D-III
(2) A-IV, B-III, C-I, D-II
(3) A-III, B-I, C-IV , D-II
(4) A-IV, B-II, C-I, D-III
उत्तर. A-IV, B-I, C-II, D-III

पुनः संयोजक डीएनए के निर्माण के मुख्य चरण नीचे दिए गए हैं इन चरणों को सही क्रम में व्यवस्थित करें A. मेजबान कोशिका में पुनः संयोजक डीएनए का सम्मिलन B. प्रतिबंध एंजाइम द्वारा डीएनए को विशिष्ट स्थान पर काटना सी. वांछित डीएनए टुकड़े का अलगाव डी. पीसीआर का उपयोग करके रुचि के जीन का प्रवर्धन नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) सी, ए, बी, डी
(2) सी, बी, डी, ए
(3) बी, डी, ए, सी
(4) बी, सी, डी, ए
उत्तर. बी, सी, डी, ए

सूची I को सूची II से सुमेलित करें: सूची I सूची II A. आयरन I. ऑक्सिन का संश्लेषण B. जिंक II नाइट्रेट रिडक्टेस का घटक सी. बोरोन III. कैटालेज़ डी. मोलिब्डेनम IV का उत्प्रेरक कोशिका दीर्घीकरण और विभेदन नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-III, C-IV, DI
(2) A-III, BI, C-IV, D-II
(3) A-II, B-IV, CI, D-III
(4) ) A-III, B-II, CI, D-IV
उत्तर. A-III, BI, C-IV, D-II

सूची I को सूची II से सुमेलित करें: सूची I सूची II A. ऑक्सीडेटिव I. साइट्रेट डीकार्बोजाइलेशन सिंथेज़ B. ग्लाइकोलाइसिस II पाइरूवेट डिहाइड्रोजनेज सी. ऑक्सीडेटिव III. इलेक्ट्रॉन फास्फारिलीकरण परिवहन प्रणाली डी. ट्राइकार्बोक्सिलिक IV ईएमपी पाथवे एसिड चक्र नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-IV, CI, D-III
(2) A-III, BI, C-II, D-IV
(3) A-II, B-IV, C-III, DI
(4) ) ए-III, बी-IV, सी-II, डीआई
उत्तर. A-II, B-IV, C-III, DI

नीचे दो कथन दिए गए हैं: एक को अभिकथन A के रूप में लेबल किया गया है और दूसरे को कारण R के रूप में लेबल किया गया है अभिकथन A: जिम्नोस्पर्म में पराग कण माइक्रोस्पोरंगियम से निकलते हैं और वायु धाराओं द्वारा ले जाए जाते हैं कारण आर: वायु धाराएँ परागकणों को आर्कगोनिया के मुँह तक ले जाती हैं जहाँ नर युग्मक मुक्त हो जाते हैं और पराग नली नहीं बनती है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सच हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए सत्य है लेकिन आर गलत है

नीचे दो कथन दिए गए हैं: एक को अभिकथन ए के रूप में लेबल किया गया है और दूसरे को कारण आर के रूप में लेबल किया गया है अभिकथन ए: एक फूल को संशोधित शूट के रूप में परिभाषित किया गया है जिसमें शूट एपिकल मेरिस्टेम पुष्प मेरिस्टेम में बदल जाता है कारण आर: प्ररोह का आंतरिक नोड संघनित होकर पत्तियों के बजाय क्रमिक नोड्स पर अलग-अलग पुष्प उपांगों का निर्माण करता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है

मेलोनेट की गतिविधि को रोककर रोगजनक बैक्टीरिया के विकास को रोकता है

(1) एमाइलेज
(2) लाइपेज
(3) डाइनाइट्रोजिनेज
(4) सक्सिनिक डिहाइड्रोजनेज
उत्तर. सक्सिनिक डिहाइड्रोजनेज

नीचे दो कथन दिए गए हैं: कथन I: एक प्रोटीन की कल्पना एक रेखा के रूप में की जाती है, बायां छोर पहले अमीनो एसिड (सी-टर्मिनल) द्वारा दर्शाया जाता है और दायां छोर अंतिम अमीनो एसिड (एनटर्मिनल) द्वारा दर्शाया जाता है कथन II: वयस्क मानव हीमोग्लोबिन में 4 सबयूनिट होते हैं (दो सबयूनिट  प्रकार के और दो सबयूनिट  प्रकार के होते हैं) उपरोक्त कथनों के आलोक में, नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सत्य है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I गलत है लेकिन कथन II सत्य है

फ़ाइलम के वयस्कों में रेडियल समरूपता नहीं पाई जाती है

(1) हेमीकोर्डेटा
(2) कोएलेंटरेटा
(3) इचिनोडर्मेटा
(4) केटेनोफोरा
उत्तर. हेमीकोर्डेटा

महिला प्रजनन चक्र के संबंध में निम्नलिखित में से कौन सा कथन सही है? A. गैर-प्राइमेट स्तनधारियों में प्रजनन के दौरान होने वाले चक्रीय परिवर्तनों को मद चक्र कहा जाता है बी. पहला मासिक धर्म यौवन पर शुरू होता है और इसे रजोनिवृत्ति कहा जाता है सी. मासिक धर्म की कमी गर्भावस्था का संकेत हो सकती है D. चक्रीय मासिक धर्म रजोदर्शन और रजोनिवृत्ति के बीच फैलता है नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) केवल ए और बी
(2) केवल ए, बी और सी
(3) केवल ए, सी और डी
(4) केवल ए और डी
उत्तर. केवल ए, सी और डी

नीचे दिए गए कथन हैं: एक को अभिकथन ए के रूप में लेबल किया गया है और दूसरे को कारण आर के रूप में लेबल किया गया है अभिकथन ए: नेफ्रॉन दो प्रकार के होते हैं: कॉर्टिकल और जक्स्टा मेडुलरी, कॉर्टेक्स और मेडुला में उनकी सापेक्ष स्थिति के आधार पर कारण आर: जुक्स्टा मेडुलरी नेफ्रॉन में हेनले का लूप छोटा होता है, जबकि कॉर्टिकल नेफ्रॉन में हेनले का लूप लंबा होता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए सत्य है लेकिन आर गलत है

मानव आँख के संबंध में सूची I को सूची II से सुमेलित करें सूची I सूची II A. फोविया I. आंख का दृश्यमान रंगीन भाग जो पुतली के व्यास को नियंत्रित करता है बी. आइरिस द्वितीय. आँख की बाहरी परत घने संयोजी ऊतक से बनी होती है सी. ब्लाइंड स्पॉट III. सबसे बड़ी दृश्य तीक्ष्णता या संकल्प का बिंदु डी. स्केलेरा IV. वह बिंदु जहां ऑप्टिक तंत्रिका नेत्रगोलक से निकलती है और फोटोरिसेप्टर कोशिकाएं अनुपस्थित होती हैं नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-IV, B-III, C-II, DI
(2) AI, B-IV, C-III, D-II
(3) A-II, BI, C-III, D-IV
(4) ) A-III, BI, C-IV, D-II
उत्तर. A-III, BI, C-IV, D-II

निम्नलिखित में से किसे एंडोमेम्ब्रेन प्रणाली का हिस्सा नहीं माना जाता है? A. माइटोकॉन्ड्रिया B. एंडोप्लाज्मिक रेटिकुलम C. क्लोरोप्लास्ट D. गॉल्जी कॉम्प्लेक्स E. पेरॉक्सिसोम्स नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) केवल ए, सी और ई
(2) केवल ए और डी
(3) केवल ए, डी और ई
(4) केवल बी और डी
उत्तर. केवल ए, सी और ई

निम्नलिखित से पीड़ित व्यक्ति में चौड़ी हथेली और एकल हथेली क्रीज दिखाई देती है –

(1) टर्नर सिंड्रोम
(2) क्लाइनफेल्टर सिंड्रोम
(3) थैलेसीमिया
(4) डाउन सिंड्रोम
उत्तर. डाउन सिंड्रोम

सूची I को सूची II से सुमेलित करें सूची I सूची II A. P – तरंग I. सिस्टोल की शुरुआत B. Q – तरंग II निलय का पुनःध्रुवीकरण सी. क्यूआरएस कॉम्प्लेक्स III. अटरिया डी. टी-तरंग IV का विध्रुवण निलय का विध्रुवण नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-IV, B-III, C-II, DI
(2) A-II, B-IV, CI, D-III
(3) AI, B-II, C-III, D-IV
(4) ) A-III, BI, C-IV, D-II
उत्तर. A-III, BI, C-IV, D-II

निम्नलिखित सामान्य यौन संचारित रोगों में से कौन-सा एक पूरी तरह से ठीक हो सकता है यदि इसका जल्दी पता चल जाए और उचित उपचार किया जाए?

(1) गोनोरिया
(2) हेपेटाइटिस-बी
(3) एचआईवी संक्रमण
(4) जननांग दाद
उत्तर. गोनोरिया

सूची I को सूची II से सुमेलित करें सूची I सूची II (कोशिकाएँ) (स्राव) A. पेप्टिक कोशिकाएँ I. बलगम B. गॉब्लेट कोशिकाएँ II पित्त रस सी. ऑक्सीनटिक कोशिकाएं III. प्रोएंजाइम पेप्सिनोजन डी. यकृत कोशिकाएं IV. विटामिन बी12 के अवशोषण के लिए एचसीएल और आंतरिक कारक नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, BI, C-III, D-IV
(2) A-III, BI, C-IV, D-II
(3) A-II, B-IV, CI, D-III
(4) ) ए-IV, बी-III, सी-II, डीआई
उत्तर. A-III, BI, C-IV, D-II

नीचे दो कथन दिए गए हैं: एक को अभिकथन ए के रूप में लेबल किया गया है और दूसरे को कारण आर के रूप में लेबल किया गया है अभिकथन ए: ब्लास्टोसिस्ट के आरोपण के लिए एंडोमेट्रियम आवश्यक है कारण आर: निषेचन की अनुपस्थिति में, कॉर्पस ल्यूटियम का क्षरण होता है जो एंडोमेट्रियम के विघटन का कारण बनता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. ए और आर दोनों सत्य हैं लेकिन आर, ए का सही स्पष्टीकरण नहीं है

निम्नलिखित में से कौन सा क्लोनिंग वेक्टर नहीं है?

(1) वाईएसी
(2) पीबीआर322
(3) जांच
(4) बीएसी
उत्तर. जांच

सूची I को सूची II से सुमेलित करें सूची I सूची II A. टेनिया I. नेफ्रिडिया B. पैरामोइकियम II संकुचनशील रिक्तिका सी. पेरिप्लानेटा III. ज्वाला कोशिकाएं डी. फेरेटिमा IV. यूरेकोज़ ग्रंथि नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) AI, B-II, C-IV, D-III
(2) A-III, B-II, C-IV, DI
(3) A-II, BI, C-IV, D-III
(4) ) एआई, बी-II, सी-III, डी-IV
उत्तर. 2

नीचे दो कथन दिए गए हैं: कथन I: स्नायुबंधन घने अनियमित ऊतक हैं कथन II: उपास्थि घना नियमित ऊतक है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सत्य है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I और कथन II दोनों गलत हैं

निम्नलिखित में से कौन सा कार्य कोशिका में साइटोस्केलेटन द्वारा किया जाता है?

(1) प्रोटीन संश्लेषण
(2) गतिशीलता
(3) परिवहन
(4) परमाणु विभाजन
उत्तर. गतिशीलता

सूची I को सूची II से सुमेलित करें सूची I सूची II A. जीन ‘ए’ I. -गैलेक्टोसिडेज़ B. जीन ‘y’ II ट्रांसएसेटाइलेज़ सी. जीन ‘आई’ III पर्मीज़ डी. जीन ‘जेड’ IV दमनकारी प्रोटीन नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-III, C-IV, DI
(2) A-III, B-IV, CI, D-II
(3) A-III, BI, C-IV, D-II
(4) ) A-II, BI, C-IV, D-III
उत्तर. A-II, B-III, C-IV, DI

निम्नलिखित कथनों में से कौन सही है ?

(1) जैव आवर्धन से तात्पर्य क्रमिक पोषी स्तरों पर विषैले पदार्थ की सांद्रता में वृद्धि से है
(2) पानी में बड़ी मात्रा में पोषक तत्वों की उपस्थिति ‘अल्गल ब्लूम’ को प्रतिबंधित करती है
(3) एल्गल ब्लूम मछली मृत्यु दर को कम करता है
(4) यूट्रोफिकेशन का तात्पर्य झीलों में घरेलू सीवेज और अपशिष्ट जल में वृद्धि से है
उत्तर. जैव आवर्धन से तात्पर्य क्रमिक पोषी स्तरों पर विषैले पदार्थ की सांद्रता में वृद्धि से है

एक बार जब अपचित और अनअवशोषित पदार्थ अंधनाल में प्रवेश कर जाते हैं, तो उनके प्रवाह को रोक दिया जाता है –

(1) इलियो-सीकल वाल्व
(2) गैस्ट्रो-एसोफेजियल स्फिंक्टर
(3) पाइलोरिक स्फिंक्टर
(4) ओड्डी स्फिंक्टर
उत्तर. इलियो-सीकल वाल्व

निम्नलिखित में से कौन सी तकनीक किसी बीमारी के शीघ्र निदान के लिए उसके शीघ्र उपचार के उद्देश्य को पूरा नहीं करती है?

(1) सीरम और मूत्र विश्लेषण
(2) पॉलीमरेज़ चेन रिएक्शन (पीसीआर) तकनीक
(3) एंजाइम लिंक्ड इम्यूनो-सॉर्बेंट परख (एलिसा) तकनीक
(4) रीकॉम्बिनेंट डीएनए टेक्नोलॉजी
उत्तर. सीरम और मूत्र विश्लेषण

नीचे दो कथन दिए गए हैं: कथन I: कम तापमान अस्थायी रूप से निष्क्रिय अवस्था में एंजाइम को संरक्षित करता है जबकि उच्च तापमान एंजाइमी गतिविधि को नष्ट कर देता है क्योंकि प्रोटीन गर्मी से विकृत हो जाते हैं कथन II: जब अवरोधक अपनी आणविक संरचना में सब्सट्रेट से काफी मिलता जुलता होता है और एंजाइम की गतिविधि को रोकता है, तो इसे प्रतिस्पर्धी अवरोधक के रूप में जाना जाता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सत्य है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I और कथन II दोनों सत्य हैं

सूची I को सूची II से सुमेलित करें सूची I सूची II (संयुक्त का प्रकार) (के बीच पाया जाता है) A. कार्टिलाजिनस I. सपाट खोपड़ी की हड्डियों के बीच का जोड़ B. बॉल और II कशेरुक स्तंभ में आसन्न सॉकेट संयुक्त कशेरुकाओं के बीच सी. रेशेदार जोड़ III. अंगूठे के कार्पल और मेटाकार्पल के बीच डी. सैडल जोड़ IV. ह्यूमरस और पेक्टोरल गर्डल के बीच नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-IV, CI, D-III
(2) AI, B-IV, C-III, D-II
(3) A-II, B-IV, C-III, DI
(4) ) ए-III, बीआई, सी-II, डी-IV
उत्तर. A-II, B-IV, CI, D-III

नीचे दो कथन दिए गए हैं: कथन I: वास डिफेरेंस वीर्य पुटिका से एक वाहिनी प्राप्त करता है और स्खलन वाहिनी के रूप में मूत्रमार्ग में खुलता है कथन II: गर्भाशय ग्रीवा की गुहा को ग्रीवा नहर कहा जाता है जो योनि के साथ मिलकर जन्म नहर बनाती है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I और कथन II दोनों सत्य हैं

एचआईवी किस रक्त कणिका में प्रतिकृति बनाकर संतति विषाणु उत्पन्न करता है?

(1) बी-लिम्फोसाइट्स
(2) बेसोफिल्स
(3) इओसिनोफिल्स
(4) टीएच कोशिकाएं
उत्तर. टीएच कोशिकाएं

सूची I को सूची II से सुमेलित करें सूची I सूची II A. हेरोइन I. हृदय प्रणाली पर प्रभाव B. मारिजुआना II शरीर की कार्यप्रणाली को धीमा करना C. कोकीन III. दर्दनिवारक डी. मॉर्फिन IV. डोपामाइन के परिवहन में हस्तक्षेप नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) AI, B-II, C-III, D-IV
(2) A-IV, B-III, C-II, DI
(3) A-III, B-IV, CI, D-II
(4) ) A-II, BI, C-IV, D-III
उत्तर. A-II, BI, C-IV, D-III

फेफड़े की महत्वपूर्ण क्षमता होती है

(1) आईआरवी + ईआरवी + टीवी + आरवी
(2) आईआरवी + ईआरवी + टीवी – आरवी
(3) आईआरवी + ईआरवी + टीवी
(4) आईआरवी + ईआरवी
उत्तर. आईआरवी + ईआरवी + टीवी

अनुकूली विकिरण प्रदर्शित करने वाले ऑस्ट्रेलियाई मार्सुपियल्स के सही समूह/सेट का चयन करें

(1) नंबैट, स्पॉटेड क्यूस्कस, फ्लाइंग फालेंजर
(2) मोल, फ्लाइंग गिलहरी, तस्मानियाई बाघ बिल्ली
(3) लेमुर, एंटईटर, भेड़िया
(4) तस्मानियाई भेड़िया, बॉबकैट, मार्सुपियल मोल
उत्तर. नंबैट, स्पॉटेड क्यूस्कस, फ्लाइंग फालेंजर

सूची I को सूची II से सुमेलित करें सूची I सूची II (ए) सीसीके (I) किडनी (बी) जीआईपी (II) हृदय (सी) एएनएफ (III) गैस्ट्रिक ग्रंथि (डी) एडीएच (IV) अग्न्याशय नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-III, B-II, C-IV, DI
(2) A-II, B-IV, CI, D-III
(3) A-IV, B-II, C-III, DI
(4) ) ए-IV, बी-III, सी-II, डीआई
उत्तर. ए-IV, बी-III, सी-II, डीआई

नीचे दो कथन दिए गए हैं: एक को अभिकथन ए के रूप में लेबल किया गया है और दूसरे को कारण आर के रूप में लेबल किया गया है अभिकथन ए: लिंग निर्धारण के लिए एमनियोसेंटेसिस प्रजनन और बाल स्वास्थ्य देखभाल कार्यक्रम की रणनीतियों में से एक है कारण आर: एमनियोसेंटेसिस पर प्रतिबंध कन्या भ्रूण हत्या के बढ़ते खतरे को रोकता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण नहीं है
(2) ए सत्य है लेकिन आर गलत है
(3) ए गलत है लेकिन आर सच है
(4) ए और आर दोनों सत्य हैं और आर, ए का सही स्पष्टीकरण है
उत्तर. 3

नीचे दो कथन दिए गए हैं: कथन I: आरएनए तेज गति से उत्परिवर्तन करता है कथन II: आरएनए जीनोम और कम जीवन काल वाले वायरस तेजी से उत्परिवर्तित और विकसित होते हैं उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सत्य है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I और कथन II दोनों सत्य हैं

सूची I को सूची II से सुमेलित करें सूची I सूची II A. पुरुष नसबंदी I. मौखिक विधि B. सहवास रुकावट II बैरियर विधि सी. सरवाइकल कैप्स III. शल्य विधि डी. सहेली IV. प्राकृतिक विधि नीचे दिए गए विकल्पों में से सही उत्तर चुनिए:

(1) A-III, B-IV, C-II, DI
(2) A-II, B-III, CI, D-IV
(3) A-IV, B-II, CI, D-III
(4) ) ए-III, बीआई, सी-IV, डी-II
उत्तर. A-III, B-IV, C-II, DI

नीचे दो कथन दिए गए हैं: कथन I: थर्मल पावर प्लांट में इलेक्ट्रोस्टैटिक प्रीसिपिटेटर का सबसे अधिक उपयोग किया जाता है कथन II: थर्मल पावर प्लांट में इलेक्ट्रोस्टैटिक प्रीसिपिटेटर आयनकारी विकिरणों को हटा देता है उपरोक्त कथनों के आलोक में, नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सही है
(4) कथन I और कथन II दोनों सही हैं
उत्तर. कथन I सही है लेकिन कथन II गलत है

नीचे दो कथन दिए गए हैं: कथन I: प्रोकैरियोट्स में, सकारात्मक रूप से चार्ज किया गया डीएनए न्यूक्लियॉइड नामक क्षेत्र में कुछ नकारात्मक चार्ज वाले प्रोटीन के साथ रखा जाता है कथन II: यूकेरियोट्स में, नकारात्मक रूप से चार्ज किया गया डीएनए न्यूक्लियोसोम बनाने के लिए सकारात्मक रूप से चार्ज किए गए हिस्टोन ऑक्टेमर के चारों ओर लपेटा जाता है उपरोक्त कथनों के आलोक में नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सत्य है
(4) कथन I और कथन II दोनों सत्य हैं
उत्तर. कथन I गलत है लेकिन कथन II सत्य है

सूची I को सूची II से सुमेलित करें सूची I सूची II A. दाद I. हीमोफिलस इन्फ्लुएंजा B. फाइलेरिया II ट्राइकोफाइटन सी. मलेरिया III. वुचेरेरिया बैनक्रॉफ्टी डी. निमोनिया IV. प्लाज्मोडियम विवैक्स नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-III, CI, D-IV
(2) A-III, B-II, CI, D-IV
(3) A-III, B-II, C-IV, DI
(4) ) A-II, B-III, C-IV, DI
उत्तर. A-II, B-III, C-IV, DI

सूची I को सूची II से सुमेलित करें सूची I सूची II (बातचीत करने वाली प्रजातियाँ) (बातचीत का नाम) A. एक तेंदुआ और I. एक जंगल/घास के मैदान में एक शेर से प्रतिस्पर्धा B. एक कोयल बिछाना II कौवे के घोंसले में ब्रूड परजीविता अंडा सी. कवक और ए III की जड़ माइकोर्टिज़े डी में पारस्परिकता उच्च पौधा एक मवेशी बगुला और IV एक खेत में मवेशी सहभोजिता नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) AI, B-II, C-IV, D-III
(2) A-III, B-IV, CI, D-II
(3) A-II, B-III, CI, D-IV
(4) ) एआई, बी-द्वितीय, सी-III, डी-IV
उत्तर. एआई, बी-द्वितीय, सी-III, डी-IV

निम्नलिखित में से कौन सा कथन सही है? A. बेसोफिल्स कुल WBCs की सबसे प्रचुर कोशिकाएं हैं B. बेसोफिल्स हिस्टामाइन, सेरोटोनिन और हेपरिन का स्राव करते हैं C. बेसोफिल्स सूजन प्रतिक्रिया में शामिल होते हैं D. बेसोफिल्स में गुर्दे के आकार का नाभिक होता है E. बेसोफिल्स एग्रानुलोसाइट्स हैं नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल सी और ई
(2) केवल बी और सी
(3) केवल ए और बी
(4) केवल डी और ई
उत्तर. केवल बी और सी

सूची I को सूची II से सुमेलित करें सूची I सूची II A. मस्त कोशिकाएं I. सिलिअटेड एपिथेलियम B. II की आंतरिक सतह एरियोलर ब्रोन्कोइल संयोजी ऊतक सी. रक्त III. घनाकार उपकला डी. ट्यूबलर भाग IV. नेफ्रॉन संयोजी ऊतक का विशेषज्ञ नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-III, CI, D-IV
(2) A-II, BI, C-IV, D-III
(3) A-III, B-IV, C-II, DI
(4) ) एआई, बी-II, सी-IV, डी-III
उत्तर. A-II, BI, C-IV, D-III

सही कथनों का चयन करें A. टेट्राड का निर्माण लेप्टोटीन के दौरान देखा जाता है बी. एनाफ़ेज़ के दौरान, सेंट्रोमियर विभाजित हो जाते हैं और क्रोमैटिड अलग हो जाते हैं C. टर्मिनलाइजेशन पचीटीन के दौरान होता है डी. टेलोफ़ेज़ के दौरान न्यूक्लियोलस, गोल्गी कॉम्प्लेक्स और ईआर का सुधार किया जाता है ई. समजात गुणसूत्र की बहन क्रोमैटिड्स के बीच क्रॉसिंग ओवर होता है नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल बी और डी
(2) केवल ए, सी और ई
(3) केवल बी और ई
(4) केवल ए और सी
उत्तर. केवल ए, सी और ई

कॉकरोच में उत्सर्जन किसके द्वारा होता है?

(1) केवल ए, बी और ई
(2) केवल बी, सी और डी
(3) केवल बी और डी
(4) केवल ए और ई
उत्तर. 2.

नीचे दो कथन दिए गए हैं: कथन I: कोशिका चक्र के G0 चरण के दौरान, कोशिका चयापचय रूप से निष्क्रिय होती है कथन II: इंटरफ़ेज़ के एस चरण के दौरान सेंट्रोसोम दोहराव से गुजरता है उपरोक्त कथनों के आलोक में, नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) कथन I और कथन II दोनों गलत हैं
(2) कथन I सही है लेकिन कथन II गलत है
(3) कथन I गलत है लेकिन कथन II सही है
(4) कथन I और कथन II दोनों सही हैं
उत्तर. कथन I गलत है लेकिन कथन II सही है

कॉर्डेट्स के संदर्भ में सही कथन का चयन करें A. मध्य पृष्ठीय, ठोस और दोहरी तंत्रिका रज्जु की उपस्थिति B. बंद परिसंचरण तंत्र की उपस्थिति C. युग्मित ग्रसनी गिलस्लिट्स की उपस्थिति D. पृष्ठीय हृदय की उपस्थिति E. त्रिप्लोब्लास्टिक स्यूडोकोइलोमेट जानवर नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल बी और सी
(2) केवल बी, डी और ई
(3) केवल सी, डी और ई
(4) केवल ए, सी और डी
उत्तर. केवल बी और सी

सूची I को सूची II से सुमेलित करें सूची I सूची II A. लॉजिस्टिक विकास I. असीमित संसाधन उपलब्धता की स्थिति B. घातीय वृद्धि II सीमित संसाधन उपलब्धता की स्थिति C. बढ़ती उम्र III. प्रजनन-पूर्व आयु वाले व्यक्तियों का प्रतिशत पिरामिड सबसे बड़ा है, इसके बाद प्रजनन और प्रजनन-पश्चात आयु समूह D. स्थिर आयु IV है प्रजनन-पूर्व और प्रजनन आयु वर्ग के व्यक्तियों का प्रतिशत पिरामिड समान है, नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) A-II, B-III, CI, D-IV
(2) A-II, B-IV, CI, D-III
(3) A-II, B-IV, C-III, DI
(4) ) A-II, BI, C-III, D-IV
उत्तर. A-II, BI, C-III, D-IV

निम्नलिखित में से कौन सा संगत कोडिंग स्ट्रैंड पर अनुक्रम है, यदि गठित mRNA पर अनुक्रम इस प्रकार है 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

(1) 3′ UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5′
(2) 5′ ATCGATCGATCGATCGATCG ATCGATCG 3′
(3) 3′ ATCGATCGATCGATCGATCG ATCGATCG 5′
(4) 5′ UAGCUAGCUAGCUAGCUAGC UAGC UAGC 3′
उत्तर. 5′ ATCGATCGATCGATCGATCG ATCGATCG 3′

लैंगिक द्विरूपता के संबंध में कॉकरोच की निम्नलिखित में से कौन सी विशेषता है?

(1) गुदा शैलियों की उपस्थिति
(2) स्क्लेराइट्स की उपस्थिति
(3) गुदा सेर्सी की उपस्थिति
(4) गहरे भूरे शरीर का रंग और गुदा सेर्सी
उत्तर. गुदा शैलियों की उपस्थिति

कंकालीय मांसपेशी के संबंध में निम्नलिखित में से कौन सा कथन सही है?
A. मांसपेशियों के बंडलों को कोलेजनस संयोजी ऊतक परत द्वारा एक साथ बांधा जाता है जिसे फ़ासिकल कहा जाता है
B. मांसपेशी फाइबर का सार्कोप्लाज्मिक रेटिकुलम कैल्शियम आयनों का भंडार गृह है
C. कंकाल की मांसपेशी फाइबर की धारीदार उपस्थिति एक्टिन और मायोसिन प्रोटीन के वितरण पैटर्न के कारण होती है
D. M रेखा को संकुचन की कार्यात्मक इकाई माना जाता है जिसे सरकोमियर कहते हैं नीचे दिए गए विकल्पों में से सबसे उपयुक्त उत्तर चुनें:

(1) केवल बी और सी
(2) केवल ए, सी और डी
(3) केवल सी और डी
(4) केवल ए, बी और सी
उत्तर. केवल बी और सी

अद्वितीय स्तनधारी विशेषताएं हैं:

(1) बाल, पिन्ना और स्तन ग्रंथियां
(2) बाल, पिन्ना और अप्रत्यक्ष विकास
(3) पिन्ना, मोनोकॉन्डिलिक खोपड़ी और स्तन ग्रंथियां
(4) बाल, कर्ण झिल्ली और स्तन ग्रंथियां
उत्तर. बाल, पिन्ना और स्तन ग्रंथियां

निम्नलिखित में से कौन सा अंतःप्रजनन का लाभ नहीं है?

(1) यह हानिकारक अप्रभावी जीन को उजागर करता है जिन्हें चयन द्वारा समाप्त कर दिया जाता है
(2) इसके कारण कम वांछनीय जीनों का उन्मूलन तथा श्रेष्ठ जीनों का संचय होता है
(3) यह निरंतर अंतःप्रजनन के बाद, अंतःप्रजनित जनसंख्या की उत्पादकता को कम कर देता है
(4) यह समयुग्मजता को कम करता है
उत्तर. यह निरंतर अंतःप्रजनन के बाद, अंतःप्रजनित जनसंख्या की उत्पादकता को कम कर देता है

मानव मस्तिष्क के वे भाग जो यौन व्यवहार, उत्तेजना, आनंद, क्रोध, भय आदि की अभिव्यक्ति के नियमन में मदद करते हैं:

(1) कॉर्पोरा क्वाड्रिजेमिना और हिप्पोकैम्पस
(2) ब्रेन स्टेम और एपिथेलमस
(3) कॉर्पस कैलोसम और थैलेमस
(4) लिम्बिक सिस्टम और हाइपोथैलेमस
उत्तर. लिम्बिक सिस्टम और हाइपोथैलेमस

निम्नलिखित में से कौन सा कथन सही है?
A. शरीर से तरल पदार्थ की अत्यधिक हानि ऑस्मोरसेप्टर्स को बंद कर देती है
B. एडीएच डायरिया को रोकने के लिए पानी के पुनर्अवशोषण की सुविधा प्रदान करता है
C. एएनएफ वासोडिलेशन का कारण बनता है
D. ADH के कारण रक्तचाप में वृद्धि होती है ई. एडीएच जीएफआर में कमी के लिए जिम्मेदार है नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल बी, सी और डी
(2) केवल ए, बी और ई
(3) केवल सी, डी और ई
(4) केवल ए और बी
उत्तर. केवल बी, सी और डी

निम्नलिखित में से कौन सा थायराइड हार्मोन के नियंत्रण में नहीं है? A. पानी और इलेक्ट्रोलाइट संतुलन बनाए रखना B. बेसल चयापचय दर का विनियमन C. नींद-जागने के चक्र की सामान्य लय D. प्रतिरक्षा प्रणाली का विकास E. RBCs के निर्माण की प्रक्रिया का समर्थन करना नीचे दिए गए विकल्पों में से सही उत्तर चुनें:

(1) केवल बी और सी
(2) केवल सी और डी
(3) केवल डी और ई
(4) केवल ए और डी
उत्तर. केवल सी और डी

इस पोस्ट मेंआपको नीट बायोलॉजी क्वेश्चन पेपर PDF NEET Biology Questions in Hindi neet question paper 2023 pdf download Neet 2023 biology question paper with solutions pdf Neet 2023 biology question paper pdf download NEET Biology Question Paper 2023 नीट 2023 जीव विज्ञान प्रश्न पत्र नीट बायोलॉजी प्रश्न पत्र से संबंधित काफी महत्वपूर्ण प्रशन और उत्तर दिए गए हैं अगर आपको यह मॉक टेस्ट जब प्रैक्टिस सेट फायदेमंद लगे तो अपने दोस्तों के साथ जरुर शेयर करें और अगर इसके बारे में आपका कोई भी सवाल या सुझाव हो तो नीचे कमेंट करके बताएं .

Show More

Related Articles

यौगिक किसे कहते हैं? परिभाषा, प्रकार और विशेषताएं | Yogik Kise Kahate Hain Circuit Breaker Kya Hai Ohm ka Niyam Power Factor Kya hai Basic Electrical in Hindi Interview Questions In Hindi